|
Shanghai Genechem Ltd
mzb1 sirna sequences ![]() Mzb1 Sirna Sequences, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mzb1 sirna sequences/product/Shanghai Genechem Ltd Average 86 stars, based on 1 article reviews
mzb1 sirna sequences - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Shanghai Genechem Ltd
shrna sequences targeting trim46 ![]() Shrna Sequences Targeting Trim46, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna sequences targeting trim46/product/Shanghai Genechem Ltd Average 86 stars, based on 1 article reviews
shrna sequences targeting trim46 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
sirna sequences ![]() Sirna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna sequences/product/Sangon Biotech Average 86 stars, based on 1 article reviews
sirna sequences - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Addgene inc
sequence 5 ggatgtaagtttgccagaagc ![]() Sequence 5 Ggatgtaagtttgccagaagc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence 5 ggatgtaagtttgccagaagc/product/Addgene inc Average 93 stars, based on 1 article reviews
sequence 5 ggatgtaagtttgccagaagc - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
sequence 5 gctcatggagactaggtttgg ![]() Sequence 5 Gctcatggagactaggtttgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence 5 gctcatggagactaggtttgg/product/Addgene inc Average 93 stars, based on 1 article reviews
sequence 5 gctcatggagactaggtttgg - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
sequence 5 gctccaacgagaagctatttg ![]() Sequence 5 Gctccaacgagaagctatttg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence 5 gctccaacgagaagctatttg/product/Addgene inc Average 93 stars, based on 1 article reviews
sequence 5 gctccaacgagaagctatttg - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
sequence 5 gttcagatgtgcggcgagt ![]() Sequence 5 Gttcagatgtgcggcgagt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence 5 gttcagatgtgcggcgagt/product/Addgene inc Average 94 stars, based on 1 article reviews
sequence 5 gttcagatgtgcggcgagt - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Addgene inc
aav plasmids encoding shrna sequences ![]() Aav Plasmids Encoding Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav plasmids encoding shrna sequences/product/Addgene inc Average 96 stars, based on 1 article reviews
aav plasmids encoding shrna sequences - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
shrna guide sequence targeting mouse mcoln1 ![]() Shrna Guide Sequence Targeting Mouse Mcoln1, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna guide sequence targeting mouse mcoln1/product/Obio Technology Corp Ltd Average 86 stars, based on 1 article reviews
shrna guide sequence targeting mouse mcoln1 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
Journal: International Dental Journal
Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation
doi: 10.1016/j.identj.2026.109452
Figure Lengend Snippet: MZB1 is significantly upregulated in gingival tissues of periodontitis patients. (A) Histogram of the number of transcriptomics differential genes in gingival tissues of patients with periodontitis. (B) Volcano plot of differentially expressed genes, highlighting MZB1 as the gene with the most significant upregulation. (C) GO biological process and KEGG pathway enrichment analysis of differentially expressed genes; upper right quadrant shows enrichment of upregulated genes, while lower left indicates downregulated genes. (D) Quantitative RT-PCR analysis of MZB1 mRNA expression in gingival tissues from periodontitis patients and healthy controls (N = 20).
Article Snippet: The specific
Techniques: Transcriptomics, Quantitative RT-PCR, Expressing
Journal: International Dental Journal
Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation
doi: 10.1016/j.identj.2026.109452
Figure Lengend Snippet: Lentiviral knockdown of MZB1 attenuates LPS-induced cytotoxicity and enhances PDLSC migration and viability. (A) Knockdown efficiency of MZB1 in PDLSCs transduced with lentivirus-mediated shRNA. (B) Western blot analysis of MZB1 protein expression. (C) Quantification of MZB1 protein levels normalised to β-Actin based on grayscale intensity (N = 3). (D) Cell viability of PDLSCs following lentiviral transduction and LPS stimulation, as measured by CCK-8 assay (N = 5). (E) Quantification of wound closure rates in the scratch assay (N = 3). (F) Quantitative analysis of cell viability by absorbance at 570 nm following crystal violet staining. (G) Representative images of wound healing assay at 24 hours post-injury. (H) Representative microscopic images of PDLSCs stained with crystal violet (comparisons in panel B are relative to Control shRNA).
Article Snippet: The specific
Techniques: Knockdown, Migration, Transduction, shRNA, Western Blot, Expressing, CCK-8 Assay, Wound Healing Assay, Staining, Control
Journal: International Dental Journal
Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation
doi: 10.1016/j.identj.2026.109452
Figure Lengend Snippet: Knockdown of MZB1 alleviates LPS-induced ER stress and apoptosis in PDLSCs. (A) Western blot chemiluminescence imaging of endoplasmic reticulum stress-related proteins, including p-PERK, ATF4, CHOP, and GPR78, in PDLSCs cells under LPS treatment. (B) Quantitative analysis of protein band intensities for p-PERK, ATF4, CHOP, and GRP78, normalised to β-Actin (N=3). (C) Flow cytometric analysis of apoptosis using Annexin V-PE and 7-AAD staining. (D) Quantification of apoptosis rates based on flow cytometry results (N = 3). (E) Western blot chemiluminescence imaging of apoptosis-related proteins BCL-2 and BAX in PDLSCs cells under LPS treatment. (F) Quantitative analysis of BCL-2 and BAX protein expression normalised to β-Actin (N=3).
Article Snippet: The specific
Techniques: Knockdown, Western Blot, Imaging, Staining, Flow Cytometry, Expressing
Journal: International Dental Journal
Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation
doi: 10.1016/j.identj.2026.109452
Figure Lengend Snippet: Knockdown of MZB1 restores osteogenic differentiation capacity of PDLSCs under inflammatory conditions (A) Microscopic images of alizarin red S staining showing calcium nodule formation after osteogenic induction of PDLSCs under different conditions. (B) Quantification of alizarin red S staining by absorbance at 560 nm (N = 3). (C) Quantitative analysis of alkaline phosphatase (ALP) activity following osteogenic induction of PDLSCs (N = 3). (D) Western blot images of osteogenic differentiation-related proteins (RUNX2, BMP2, α-SMA, and Collagen I) in PDLSCs. (E) Quantification of Western blot bands normalised to β-Actin, representing relative expression levels of osteogenic markers (N = 3).
Article Snippet: The specific
Techniques: Knockdown, Staining, Activity Assay, Western Blot, Expressing
Journal: International Dental Journal
Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation
doi: 10.1016/j.identj.2026.109452
Figure Lengend Snippet: AAV-mediated knockdown of MZB1 alleviates periodontal inflammation and tissue damage in a rat model of periodontitis. (A) Western blot analysis of MZB1 protein expression in rat periodontal tissues. (B) Quantitative densitometry of MZB1 protein expression normalised to β-Actin (N = 3). (C) Body weight changes in rats after AAV-mediated knockdown of MZB1 in the periodontitis model (N = 6). (D) Representative H&E-stained images of rat periodontal tissue sections. (E) Quantitative analysis of histopathological parameters, including inflammatory cell infiltration, alveolar bone resorption, and loss of periodontal attachment (N = 6). (F) ELISA-based quantification of inflammatory cytokines TNF-α, IL-6, IL-17A, and anti-inflammatory factor TGF-β1 in rat periodontal tissues (N = 6).
Article Snippet: The specific
Techniques: Knockdown, Western Blot, Expressing, Staining, Enzyme-linked Immunosorbent Assay
Journal: International Dental Journal
Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation
doi: 10.1016/j.identj.2026.109452
Figure Lengend Snippet: Knockdown of MZB1 reduces apoptosis in periodontal tissues of rats with periodontitis. (A) Representative TUNEL-stained images (80 ×) of rat periodontal tissue sections. Apoptotic cells are labeled with green fluorescence, and nuclei are counterstained with DAPI (blue). (B) Quantitative analysis of apoptotic cell ratio in TUNEL-stained sections (N = 5). (C) Western blot analysis of apoptosis-related proteins (BAX and BCL-2) in rat periodontal tissues. (D) Quantification of BAX and BCL-2 protein expression normalised to β-Actin (N = 3). (* P < .05, ** P < .01, *** P < .001, **** P < .0001).
Article Snippet: The specific
Techniques: Knockdown, TUNEL Assay, Staining, Labeling, Fluorescence, Western Blot, Expressing
Journal: Oncology Reports
Article Title: TRIM46 deficiency-induced DNA damage enhances the sensitivity of cisplatin in non-small cell lung cancer by regulating the Akt signaling pathway
doi: 10.3892/or.2026.9063
Figure Lengend Snippet: TRIM46 expression is associated with DDP resistance in non-small cell lung cancer tissues. (A) Immunohistochemistry staining was performed using a TRIM46 antibody and normal, DDP-sensitive and DDP-resistant tissues. (B) Percentages of tissues with low or high TRIM46 expression in DDP-sensitive (n=38) or DDP-resistant (n=47) patients. (C) Percentages of patients with DDP-resistant or DDP-sensitive tissues and low (n=44) or high (n=41) TRIM46 expression. ***P<0.001. TRIM46, tripartite motif 46; DDP, cisplatin.
Article Snippet: The
Techniques: Expressing, Immunohistochemistry, Staining
Journal: Oncology Reports
Article Title: TRIM46 deficiency-induced DNA damage enhances the sensitivity of cisplatin in non-small cell lung cancer by regulating the Akt signaling pathway
doi: 10.3892/or.2026.9063
Figure Lengend Snippet: TRIM46 upregulation contributes to DDP resistance in non-small cell lung cancer cells. (A) RT-qPCR (left) and western blot (right) analysis of TRIM46 expression in 16HBE, A549 and A549/DDP cells. (B) RT-qPCR (left) and western blot (right) analysis of TRIM46 expression in A549 cells infected with TRIM46 overexpression lentivirus. (C) Cell apoptosis was measured after transduction with TRIM46-overexpression lentivirus and/or DDP treatment (0, 5 and 10 µM) in A549 cells. (D) Quantitative analysis of cell apoptosis. (E) Representative images of the comet assay showing DNA fragmentation after transduction with TRIM46-overexpression lentivirus and/or DDP treatment (0, 5 and 10 µM) in A549 cells (scale bar, 50 µm; magnification, ×400). (F) Quantification of tail DNA (%) revealing DNA damage after transduction with TRIM46-overexpression lentivirus and/or DDP treatment (0, 5 and 10 µM) in A549 cells. *P<0.05, **P<0.01, ***P<0.001. TRIM46, tripartite motif 46; DDP, cisplatin; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; PI, propidium iodide.
Article Snippet: The
Techniques: Quantitative RT-PCR, Western Blot, Expressing, Infection, Over Expression, Transduction, Single Cell Gel Electrophoresis, Reverse Transcription, Real-time Polymerase Chain Reaction
Journal: Oncology Reports
Article Title: TRIM46 deficiency-induced DNA damage enhances the sensitivity of cisplatin in non-small cell lung cancer by regulating the Akt signaling pathway
doi: 10.3892/or.2026.9063
Figure Lengend Snippet: TRIM46 knockdown alleviates DDP resistance in non-small cell lung cancer cells. (A) Reverse transcription-quantitative polymerase chain reaction (left) and western blot (right) analysis of TRIM46 expression in A549/DPP cells infected with TRIM46 knockdown lentiviruses. (B) Cell apoptosis was measured after transduction with TRIM46 knockdown lentivirus and/or DDP treatment (0, 50 and 100 µM) in A549/DDP cells. (C) Quantitative analysis of cell apoptosis. (D) Representative images of the comet assay showing DNA fragmentation after transduction with TRIM46 knockdown lentivirus and/or DDP treatment (0, 50 and 100 µM) in A549/DDP cells (scale bar, 50 µm; magnification, ×400). (E) Quantification of tail DNA (%) revealing DNA damage after transduction with TRIM46 knockdown lentivirus and/or DDP treatment (0, 50 and 100 µM) in A549/DDP cells. ***P<0.001. TRIM46, tripartite motif 46; DDP, cisplatin; sh, short hairpin; NC, negative control; PI, propidium iodide.
Article Snippet: The
Techniques: Knockdown, Reverse Transcription, Real-time Polymerase Chain Reaction, Western Blot, Expressing, Infection, Transduction, Single Cell Gel Electrophoresis, Negative Control
Journal: Oncology Reports
Article Title: TRIM46 deficiency-induced DNA damage enhances the sensitivity of cisplatin in non-small cell lung cancer by regulating the Akt signaling pathway
doi: 10.3892/or.2026.9063
Figure Lengend Snippet: TRIM46 depletion inhibits cell proliferation by regulating the Akt signaling pathway. (A) Cell proliferation of A549/DDP cells transduced with TRIM46-knockdown lentiviruses. (B) Western blot analysis of p-Akt, Akt, caspase 3, cleaved-caspase 3 and RAD51 expression in A549/DDP cells transduced with TRIM46-knockdown lentiviruses. (C) Cell proliferation of A549 cells transduced with TRIM46-overexpression lentivirus and/or treated with LY294002 (20 µM) or vehicle. (D) Western blot analysis of p-Akt, Akt, caspase 3, cleaved-caspase 3 and RAD51 in A549 cells transduced with TRIM46-overexpression lentivirus and/or treated with LY294002 (20 µM) or vehicle. ***P<0.001 vs. shNC or Vector + Vehicle; ### P<0.001 vs. TRIM46 + Vehicle. TRIM46, tripartite motif 46; DDP, cisplatin; sh, short hairpin; NC, negative control; OD, optical density; p-, phosphorylated.
Article Snippet: The
Techniques: Transduction, Knockdown, Western Blot, Expressing, Over Expression, Plasmid Preparation, Negative Control
Journal: Oncology Reports
Article Title: TRIM46 deficiency-induced DNA damage enhances the sensitivity of cisplatin in non-small cell lung cancer by regulating the Akt signaling pathway
doi: 10.3892/or.2026.9063
Figure Lengend Snippet: TRIM46 knockdown increases the sensitivity of xenograft tumors to DDP treatment. (A) Tumor volumes and (B) images of xenograft tumors in the designated groups (scale bar, 1 cm; n=6 per group). (C) TUNEL assay of xenograft tumor samples (scale bar, 100 µm; magnification, ×200). (D) Statistical analysis of the TUNEL assay (n=6 per group). (E) Western blot analysis of TRIM46 and RAD51 expression in xenograft tumors. ***P<0.001. TRIM46, tripartite motif 46; DDP, cisplatin; sh, short hairpin; NC, negative control.
Article Snippet: The
Techniques: Knockdown, TUNEL Assay, Western Blot, Expressing, Negative Control
Journal: Oncology Reports
Article Title: TRIM46 deficiency-induced DNA damage enhances the sensitivity of cisplatin in non-small cell lung cancer by regulating the Akt signaling pathway
doi: 10.3892/or.2026.9063
Figure Lengend Snippet: Mechanism of TRIM46 deficiency-induced DNA damage, enhancing the sensitivity of DDP in NSCLC by regulating Akt signaling pathway. (A) TRIM46 expression was positively associated with DDP resistance in NSCLC tissues. (B) TRIM46 overexpression significantly suppressed DDP-induced apoptosis and enhanced DDP resistance in A549 cells. (C) TRIM46 knockdown induced DNA damage by modulating the protein levels of p-AKT, RAD51, caspase 3, and cleaved-caspase 3, thereby resulting in cell proliferation inhibition in NSCLC cells. (D) TRIM46 knockdown increased the sensitivity of xenograft tumors to DDP treatment. NSCLC, non-small cell lung cancer; TRIM46, tripartite motif 46; DDP, cisplatin; p-, phosphorylated.
Article Snippet: The
Techniques: Expressing, Over Expression, Knockdown, Inhibition